Biokätkö Mystery Cache

Tervetuloa molekyylibiologian ihmeelliseen maailmaan! Sinun ei tarvitse olla biologi ratkaistaksesi tämän mysteerin, vaan se onnistuu päättelykykyä ja Internetiä käyttämällä. Kärsivällisyydestäkin on apua.

Welcome to the amazing world of molecular biology! You don't have to be a biologist to solve this mystery. Instead, it's possible with the help of reasoning skills and the Internet. Patience helps, too!

Geneettinen koodi ilmoittaa, mitkä kolmen emäsparin jonot eli kodonit DNA- tai RNA-molekyylissä vastaavat proteiinisynteesissä mitäkin aminohappoa. Solun geenit ovat nukleotideista koostuvia DNA-säikeitä. Kun proteiinia valmistetaan, geenin DNA kopioidaan lähetti-RNA:ksi, jonka mukaan proteiini tuotetaan. Emäksiä on neljää erilaista. DNA:ssa ne ovat adeniini A, tymiini T, sytosiini C tai guaniini G. Lähetti-RNA:ssa on tymiinin paikalla urasiili U. DNA:ssa tai RNA:ssa oleva kodoni eli kolmen emäksen jono vastaa aina yhtä aminohappoa tai ohjausmerkkiä. Esimerkiksi metioniinia vastaa RNA:ssa kodoni adeniini-urasiili-guaniini, joka merkitään lyhyemmin AUG. Näin ollen kodonissa voi olla kolme eri emästä, mutta neljää eri tyyppiä. Kolmesta neljäntyyppisestä emäksestä voidaan muodostaa 43 eli 64 erilaista kolmen emäksen jonoa. Koska aminohappoja on vain 20, montaa aminohappoa vastaa useita eri emäsyhdistelmiä eli kodonia. (Wikipedia)

Kuvitellaan, että seuraava DNA-sekvenssi toimii mallijuosteena transkriptiossa:

TACAAACTCCGTAAGCGAGTTGTAGGGTCGCGCAAACCCGTTACAATGCGTGATTTTCTCAAAGTTCGCAAGTATGTATACGGAGAAA
AGCGGCGGCAGCCCAAACGCTAACGTACGAAGAATGAATATGTGGACTGGATACTGAACAGGTACGACATC

Muunna DNA RNA:ksi ja RNA edelleen proteiiniksi, tarkalleen ottaen sen aminohapposekvenssiksi.

Tutki aminohapposekvenssiä ja ota siitä ylös seuraavat luvut:

a = alaniinin (Ala/A) määrä

b = leusiinin (Leu/L) määrä

c = glutamiinin (Gln/Q) määrä

d = tryptofaanin (Trp/W) määrä

e = fenyylialaniinin (Phe/F) määrä

Kätkön koordinaatit ovat

N 61° 54,aba

E 025° 09,cde

The genetic code is the set of rules by which information encoded within genetic material (DNA or mRNA sequences) is translated into proteins by living cells. Biological decoding is accomplished by the ribosome, which links amino acids in an order specified by mRNA, using transfer RNA (tRNA) molecules to carry amino acids and to read the mRNA three nucleotides at a time. The genetic code is highly similar among all organisms and can be expressed in a simple table with 64 entries. The code defines how sequences of these nucleotide triplets, called codons, specify which amino acid will be added next during protein synthesis. With some exceptions, a three-nucleotide codon in a nucleic acid sequence specifies a single amino acid. Because the vast majority of genes are encoded with exactly the same code (see the RNA codon table), this particular code is often referred to as the canonical or standard genetic code, or simply the genetic code, though in fact some variant codes have evolved. For example, protein synthesis in human mitochondria relies on a genetic code that differs from the standard genetic code. (Wikipedia)

Let's imagine that the following DNA sequence is used as a template strand in transcription:

TACAAACTCCGTAAGCGAGTTGTAGGGTCGCGCAAACCCGTTACAATGCGTGATTTTCTCAAAGTTCGCAAGTATGTATACGGAGAAA
AGCGGCGGCAGCCCAAACGCTAACGTACGAAGAATGAATATGTGGACTGGATACTGAACAGGTACGACATC

Convert the DNA to RNA and the RNA to protein (or amino acid sequence, to be exact).

Examine the amino acid sequence and note the following numbers:

a = alanine (Ala/A) count

b = leucine (Leu/L) count

c = glutamine (Gln/Q) count

d = tryptophan (Trp/W) count

e = phenylalaine (Phe/F) count

The final coordinates are

N 61° 54.aba

E 025° 09.cde