In 2003, the thirteen-year-long Human Genome Project was completed. The project identified the exact sequence of the three billion genetic base pairs (known as nucleotides) that makes up human DNA. They also identified all of the genes (sequences of nucleotides that code for a specific trait, like eye color) that influence our physical traits.
More recently, it was discovered that there is a specific nucleotide sequence that is unique to a subspecies of humans known as "Geocachers". This nucleotide sequence makes up a gene that codes for the innate ability to find what you're looking for. The exact sequence is as follows:
5' CTCATTTTGCTGCCAGGTGCTCTTAATACT
CGTATGCCCTATTTCGCGTACCTGGAACCA
CAGGATGTTGGTGTGGCCAATCTCTTCGTT
TATATTCTCATTTATGTTTAGGATATTGTT 3'
5' (five-prime) and 3' (three-prime) refer to which direction the strand of nucleotides is arranged. When two strands of nucleotides bind, like in normal DNA or when protein synthesis is taking place, they always run in opposite directions. The strand is always read 5'>3'.
Congratulations to Kelinore and JayB10 for FTF!