After years of graduate work in chemical and molecular sciences, it was inevitable that I would get embroiled in the infamous 'evolution/creation debate'. I usually actually stay out of the debate, but one of the things that has been 'missing' is the link that connects the organisms.
When I was preparing to come to Rock Springs, I encountered an article from December 9, 1966 Science Magazine that reported on the oldest bat on record, found right in the Green River Basin area!! Since there are so many fossils in the area, I figured that this was the best place to look for that infamous "Missing Link". I found it!! But of course, I can not blab the answer to the world as to where it is, but I figured that the geocachers would understand the importance of preserving the area, so I set out to find a way to publish the location without telling everyone. As I was pondering it, I got an email. It was from my friend at the sequencing facility at Penn State University where I had sent some DNA that I scratched off the Missing Link. She sent back the sequence of the DNA and I discovered that within the the sequence actually was the location!!! All you have to do is solve this sequence to get the location of the cache. You can do it manually if you can find a way to crack it, but if you really know what you are looking at, there are programs online that can help solve it. Here it is:
aaccgcacccattttcgcacctataacgaagatgaaggccgcgaagaaagcacccatatt cgcacctatacctggccgattaacaccgaaattggccataccacctggaacattaacgaa tgggaaagcaccaacgaacataacgatcgcgaagataacattaacgaagatgaaggccgc gaagaaagcacctgggaaaacacctattttattgtggaaccgattaacaccacctggacc catattcgcacctataacgaa
You can check your answers for this puzzle on Geochecker.com.